On this very special live broadcast of the DarkHorse podcast, Dr. Bret Weinstein (Ph.D) and Dr. Pierre Kory (M.D.) will discuss the ongoing pandemic, the care of COVID-19 patients, and the incredible story of Ivermectin.

[player url="https://odysee.com/@crotacheese75:e/DarkHorse-Podcast-with-Pierre-Kory-And-Bret-Weinstein:b" title="COVID, Ivermectin, and the Crime of the Century - DarkHorse Podcast with Pierre Kory & Bret Weinstein" summary="On this very special live broadcast of the DarkHorse podcast, Dr. Bret Weinstein (Ph.D) and Dr. Pierre Kory (M.D.) will discuss the ongoing pandemic, the care of COVID-19 patients, and the incredible ..."]

POSTED BY: DR. JOSEPH MERCOLA JUNE 22, 2021

In the video above, DarkHorse podcast host Bret Weinstein, Ph.D., an evolutionary biologist, interviews Dr. Robert Malone, the inventor of the mRNA and DNA vaccine core platform technology,¹ and Steve Kirsch, an entrepreneur who has been researching adverse reactions to COVID-19 gene therapies.

I realize that this is an absolutely epic three-hour interview but if you ever valued what I have been teaching, you must at a bare minimum very carefully read this entire article.

Malone is the scientist that actually invented the technology that makes the COVID jab possible and he spills the beans on just how this introduction has been ethically compromised to make informed consent absolutely impossible for the average person. Watch the interview if your schedule allows, but carefully read this article for sure.

[player url="https://www.youtube.com/watch?v=Du2wm5nhTXY" title="Spike protein is very dangerous, it's cytotoxic (Robert Malone, Steve Kirsch, Bret Weinstein)" summary="Spike protein is very dangerous, it's cytotoxic. Clip from DarkHorse podcast. Full livestream now CENSORED on YouTube.Odysee for backup: https://odysee.com/@..."]

Kirsch recently published the article, “Should You Get Vaccinated?” in which he reviews how and why he has changed his mind about the COVID-19 “vaccines.” This after he got both doses of the Moderna shot, as have his three daughters.

If you or someone you know is equivocal about the COVID jab, then please, you simply MUST read Kirsh’s article as it is clearly one of the best pieces written on the topic and provides the other side of the story that is NEVER given in the mainstream media. Remember, without full disclosure of the vaccine’s risk, it is impossible to have informed consent.² If you read Kirsch’s article, you will get, in great detail, the other side that the conventional media refuses to share. He writes:

“I recently learned that these vaccines have likely killed over 25,800 Americans (which I confirmed 3 different ways) and disabled at least 1,000,000 more. And we’re only halfway to the finish line. We need to PAUSE these vaccines NOW before more people are killed.

Based on what I now know about the miniscule vaccine benefits (approximately a 0.3% reduction in absolute risk), side effects (including death), current COVID rates, and the success rate of early treatment protocols, the answer I would give today to anyone asking me for advice as to whether to take any of the current vaccines would be, ‘Just say NO.’

The current vaccines are particularly contraindicated if you have already been infected with COVID or are under age 20. For these people, I would say ‘NO! NO! NO!’

In this article, I will explain what I have learned since I was vaccinated that totally changed my mind. You will learn how these vaccines work and the shortcuts that led to the mistakes that were made.

You will understand why there are so many side effects and why these are so varied and why they usually happen within 30 days of vaccination. You will understand why kids are having heart issues (for which there is no treatment), and temporarily losing their sight, and ability to talk. You will understand why as many as 3% may be severely disabled by the vaccine.”

The Spike Protein Is a Bioactive Cytotoxin

As explained by Malone, many months ago he warned the U.S. Food and Drug Administration that the spike protein — which the COVID-19 “vaccines” instruct your cells to make — could be dangerous. The FDA dismissed his concerns, saying they did not believe the spike protein was biologically active. Besides, the vaccine makers specifically designed the injections so that the spike protein would stick and not float about freely.

Well, they were wrong on both accounts. It’s since been well-established that, indeed, the SARS-CoV-2 spike protein gets free, and that it is biologically active and causes severe problems. It is responsible for the most severe effects seen in COVID-19, such as bleeding disorders, blood clots throughout the body and heart problems.

These are the same problems we now see in a staggering number of people having received one or two shots of COVID-19 “vaccine.” For more in-depth information about how the spike protein causes these problems, please see my interview with Stephanie Seneff, Ph.D., and Judy Mikovits, Ph.D.

Using the word vaccine isn’t really appropriate here, and I don’t want to contribute to the misuse of that word. These injections are clearly not vaccines. They don’t work like any previous conventional vaccines. As the actual inventor of the mRNA vaccines clearly says in the interview, they are gene therapy. So, please understand that when I say vaccine or vaccination, I’m really talking about gene therapy.

Spike Protein Disseminates Throughout Your Body

In a recent interview³ with Alex Pierson, Canadian immunologist and vaccine researcher Byram Bridle, Ph.D., discussed previously unseen research obtained from the Japanese regulatory agency through a freedom of information act request.

The study was a biodistribution study done by Pfizer, which showed that the mRNA in the vaccine does not stay in and around the vaccination site but is widely distributed in the body, as is the spike protein.⁴

This is a serious problem, as the spike protein is a toxin shown to cause cardiovascular and neurological damage. Once in your blood circulation, the spike protein binds to platelet receptors and the cells that line your blood vessels. When that happens, it can cause platelets to clump together, resulting in blood clots, and/or cause abnormal bleeding. I detailed these and other findings in “Researcher: ‘We Made a Big Mistake’ on COVID-19 Vaccine.”

Dangerous Corners Were Cut

The spike protein also has reproductive toxicity, and Pfizer’s biodistribution data show it accumulates in women’s ovaries. Kirsch cites data suggesting the miscarriage rate among women who get the COVID “vaccine” within the first 20 weeks of pregnancy is 82%.⁵ The normal rate is 10%, so this is no minor uptick. Kirsch writes:⁶

“It is baffling that the CDC says the vaccine is safe for pregnant women when it is so clear that this is not the case. For example, one our family friends is a victim of this. She miscarried at 25 weeks … She had her first shot 7 weeks ago, and her second shot 4 weeks ago.

The baby had severe bleeding of the brain and other disfigurements. Her gynecologist had never seen anything like that before in her life. They called in a specialist who said it was probably a genetic defect (because everyone buys into the narrative that the vaccine is safe it is always ruled out as a possible cause).

No VAERS report. No CDC report. Yet the doctors I’ve talked to say that it is over 99% certain it was the vaccine. The family doesn’t want an autopsy for fear that their daughter will find out it was the vaccine. This is a perfect example of how these horrible side effects just never get reported anywhere.”

Disturbingly, the Pfizer biodistribution data package reveals that corners were cut in the interest of speed, and one of the research facets that were skipped was reproductive toxicology. Yet, despite the lack of an initial reproductive toxicology investigation and a rapidly growing number of reports of miscarriages (which is likely to be a significant undercount), the Centers for Disease Control and Prevention is still urging pregnant women to get vaccinated. Why is that?

Is There Purposeful Suppression of VAERS Data?

What’s more, as discussed in the interview, there’s evidence that data in the Vaccine Adverse Event Reporting System (VAERS) is being manipulated as reports that were filed are now missing. Why were they removed? And without the filers’ consent?

Even with that manipulation, the number of deaths reported post-vaccination against COVID-19 is beyond anything we’ve ever seen. According to Kirsch, the rate of death from COVID-19 shots exceeds that of more than 70 vaccines combined over the past 30 years, and it’s about 500 times deadlier than the seasonal flu vaccine,⁷ which historically has been the most hazardous.

Other serious effects are also off the charts. For example, Israeli data show boys and men between the ages of 16 and 24 who have been vaccinated have 25 times the rate of myocarditis (heart inflammation) than normal.⁸ Additionally, many young people are actually dying as a result of this myocarditis.⁹

Malone points out that, in re-reading the most current version of the Emergency Use Authorization (EUA) that governs these COVID shots, he discovered that the FDA opted not to require stringent post-vaccination data collection and evaluation, even though they had the latitude to do so.

As noted by Weinstein, this is yet another anomaly that needs an answer. Why did they opt for such lax data capture, because without it, there’s no way of evaluating the safety of these products. You cannot identify the danger signals if you don’t have a process for capturing effects data and evaluating all of it.

“The whole logic of EUA is you’re basically substituting real-time capture of key information for prospective capture of key information,” Malone explains. “But to do that, you’ve got to get the information and it has to be rigorous.”

Other Anomalies

Furthermore, as noted by Weinstein, if you release a vaccine under emergency use — because you say there’s an unprecedented health emergency and there are no other options, therefore it’s worth taking a larger than normal risk — then you still would not give it to people who are at no or low risk of the disease in question.

This would include children, teens and healthy individuals under the age of 40, at bare minimum. Children appear naturally immune against COVID-19¹⁰ and have been shown to not be disease vectors,¹¹ and people under 40 have an infection fatality ratio of just 0.01%.¹² That means their chances of survival is 99.99%, which is about as good as it gets.

Pregnant women would also be excluded as they are a high-risk category for any experimentation, and anyone who has recovered from COVID would be excluded as they now have natural immunity and have no need for a vaccine whatsoever. In fact, a recent Cleveland Clinic study^13,14 found people who had tested positive for SARS-CoV-2 at least 42 days prior to vaccination reaped no additional benefit from the jabs.

Yet all of these incredibly low-risk groups are urged and even inappropriately incentivized to get vaccinated, and this too is anomalous behavior. Part of the risk-benefit analysis is not only the risk of serious outcomes and death from the disease, but also the availability of alternative treatments, and here we have the third massive anomaly.

We’ve seen a clear suppression of information showing that there are not just one but several effective remedies that could reduce the risk of COVID-19 to a number of cohorts down to virtually zero. Examples include hydroxychloroquine and ivermectin, both of which have been safely used for decades in many millions of people around the world.

The precautionary principle dictates that as long as a drug or treatment strategy doesn’t do harm, even if the positive effect may be small, it should be used until better data or better treatments becomes available. This is the logic they used with masks (even though the data overwhelmingly showed no statistical benefit and there are a number of potential harms).

But when it comes to hydroxychloroquine and ivermectin, they suppressed the use of these drugs even though they are extremely safe when used in the appropriate doses and have been shown to work really well in many dozens of studies. As noted by Kirsch in his article:¹⁵

“Repurposed drugs [such as hydroxychloroquine and ivermectin] are safer and more effective than the current vaccines. In general, early treatment with an effective protocol reduces your risk of dying by more than 100X so instead of 600,000 deaths, we’d have fewer than 6,000 deaths. NOTE: The vaccine has already killed over 6,000 people and that’s from the vaccine alone (and doesn’t count any breakthrough deaths).”

Doctors are also being muzzled and their warnings suppressed and censored. Dr. Charles Hoffe has administered Moderna’s COVID-19 “vaccine” to 900 of his patients. Three are now permanently disabled and one has died. After writing an open letter to Dr. Bonnie Henry, the provincial health officer for British Columbia, in which he stated that he’s “been quite alarmed at the high rate of serious side-effects from this novel treatment,”¹⁶ his hospital privileges were yanked.

Bioethics Laws Are Clearly Being Broken

In a May 30, 2021, essay,¹⁷ Malone reviewed the importance of informed consent, rightly concluding that censorship makes it so that informed consent simply cannot be given. Informed consent isn’t just a nice idea or an ideal. It is the law, both nationally and internationally. The current vaccine push also violates bioethical principles in general.

“By way of background, please understand that I am a vaccine specialist and advocate, as well as the original inventor of the mRNA vaccine (and DNA vaccine) core platform technology. But I also have extensive training in bioethics from the University of Maryland, Walter Reed Army Institute of Research, and Harvard Medical School, and advanced clinical development and regulatory affairs are core competencies for me,” Malone writes.

“Why is it necessary to suppress discussion and full disclosure of information concerning mRNA reactogenicity and safety risks? Let’s analyze the vaccine-related adverse event data rigorously. Is there information or patterns that can be found, such as the recent finding of the cardiomyopathy signals, or the latent virus reactivation signals?

We should be enlisting the best biostatistics and machine learning experts to examine these data, and the results should — no must — be made available to the public promptly. Please follow along and take a moment to examine the underlying bioethics of this situation with me …

The suppression of information, discussion, and outright censorship concerning these current COVID vaccines which are based on gene therapy technologies cast a bad light on the entire vaccine enterprise. It is my opinion that the adult public can handle information and open discussion. Furthermore, we must fully disclose any and all risks associated with these experimental research products.

In this context, the adult public are basically research subjects that are not being required to sign informed consent due to EUA waiver. But that does not mean that they do not deserve the full disclosure of risks that one would normally require in an informed consent document for a clinical trial.

And now some national authorities are calling on the deployment of EUA vaccines to adolescents and the young, which by definition are not able to directly provide informed consent to participate in clinical research — written or otherwise.

The key point here is that what is being done by suppressing open disclosure and debate concerning the profile of adverse events associated with these vaccines violates fundamental bioethical principles for clinical research. This goes back to the Geneva convention and the Helsinki declaration.¹⁸ There must be informed consent for experimentation on human subjects.”

Experimentation without proper informed consent also violates the Nuremberg Code,¹⁹ which spells out a set of research ethics principles for human experimentation. This set of principles were developed to ensure the medical horrors discovered during the Nuremberg trials at the end of World War II would never take place again.

Lines Have Been Crossed That Must Never Be Crossed

In the U.S., we also have the Belmont report,²⁰ cited in Malone’s essay, which spells out the ethical principles and guidelines for the protection of human subjects of research, covered under the U.S. Code of Federal Regulations 45 CFR 46 (subpart A). The Belmont report describes informed consent as follows:

“Respect for persons requires that subjects, to the degree that they are capable, be given the opportunity to choose what shall or shall not happen to them. This opportunity is provided when adequate standards for informed consent are satisfied.

While the importance of informed consent is unquestioned, controversy prevails over the nature and possibility of an informed consent. Nonetheless, there is widespread agreement that the consent process can be analyzed as containing three elements: information, comprehension and voluntariness.”

Americans, indeed the people of the whole earth, are being prevented from freely accessing and sharing information about these gene therapies. Worse, we are misled by fact checkers and Big Tech platforms that ban or put misinformation labels on anyone and anything discussing them in a critical or questioning way. The same censorship also prevents comprehension of risk.

Lastly, government and any number of vaccine stakeholders are encouraging companies and schools to make these experimental injections mandatory, which violates the rule of voluntariness. Government and private businesses are also creating massive incentives to participate in this experiment, including million-dollar lotteries and full college scholarships. None of this is ethical or even legal. As noted by Malone:²¹

“… as these vaccines are not yet market authorized (licensed), coercion of human subjects to participate in medical experimentation is specifically forbidden. Therefore, public health policies which meet generally accepted criteria for coercion to participate in clinical research are forbidden.

For example, if I were to propose a clinical trial involving children and entice participation by giving out ice cream to those willing to participate, any institutional human subjects safety board (IRB) in the United States would reject that protocol.

If I were to propose a clinical research protocol wherein the population of a geographic region would lose personal liberties unless 70% of the population participated in my study, once again, that protocol would be rejected by any US IRB based on coercion of subject participation. No coercion to participate in the study is allowed.

In human subject clinical research, in most countries of the world this is considered a bright line that cannot be crossed. So, now we are told to waive that requirement without even so much as open public discussion being allowed? In conclusion, I hope that you will join me; stop to take a moment and consider for yourself what is going on. The logic seems clear to me.

Again, if your schedule allows, I sincerely hope you take the time to listen to Weinstein’s interview with Malone and Kirsch. Yes, it is very long — about 3 ½ hours — but they are all astute in their observations, which makes for an enlightening conversation. And remember to read and widely share Kirsch’s article, “Should You Get Vaccinated?”²²

The National Vaccine Information Center (NVIC) recently posted more than 50 video presentations from the pay-for-view Fifth International Public Conference on Vaccination held online October 16 to 18, 2020, and made them available to everyone for free.

The conference’s theme was “Protecting Health and Autonomy in the 21st Century” and it featured physicians, scientists and other health professionals, human rights activists, faith community leaders, constitutional and civil rights attorneys, authors and parents of vaccine injured children talking about vaccine science, policy, law and ethics and infectious diseases, including coronavirus and COVID-19 vaccines.

In December 2020, a U.K. company published false and misleading information about NVIC and its conference, which prompted NVIC to open up the whole conference for free viewing. The conference has everything you need to educate yourself and protect your personal freedoms and liberties with respect to your health.

Don’t miss out on this incredible opportunity. I was a speaker at this empowering conference and urge you to watch these video presentations before they’re censored and taken away by the technocratic elite.

Read full story here…

.

Camilla Canepa

The parents of the 18-year-old who died: "She had no disease." The chief physician who operated on her: "Extremely severe thrombosis"

CLICK IMAGE AVOVE TO HEAR THE DISCUSSION TOPIC

CLICK IMAGE TO HEAR THE DISCUSSIONS 

WATCH HIGHWIRE VIDEO

World renown vaccine specialist, Geert Vanden Bossche, gave a groundbreaking interview this week risking his reputation and his career by bravely speaking out against administration of #Covid19 vaccines. In what may be one of the most important stories ever covered by The Highwire, the vaccine developer shared his extreme concerns about these vaccines in particular and why we may be on track to creating a global immunity catastrophe.

Internet Source TheHighWire.com

CLICK IMAGE ABOVE TO HEAR EXPERT MEDICAL OPINIONS

also view this interview between concerned doctors

James Perloff shares information from his new book titled COVID-19 and the Agendas to Come, Red-Pilled which reveals what the social engineers have in store for the future of humanity.

COVID-19 AND THE AGENDAS TO COME, RED-PILLED

Dire WARNING: DO NOT GET THE COVID VACCINE!!

by Brian Shilhavy
Editor, Health Impact News

In an effort to combat Big Pharma Corporate Media and Big Tech censorship, doctors around the world are frantically trying to warn the masses of the devastating effects of the experimental COVID vaccines about to be mass injected into the unsuspecting public assisted by military forces around the world.

What could possibly motivate these doctors, nurses, scientists, and other health professionals to make such an impassioned plea? What do they have to gain by taking the time to educate the public on the hidden dangers of a new class of vaccine about to be inflicted upon the citizens of countries around the world?

They have NOTHING TO GAIN, and much to lose, including their careers, and possibly even their lives.

So why are they doing this? Why are these doctors and professionals being censored so much if the new COVID vaccines are in fact “safe and effective”? What is it that the media and the government are hiding that they don’t want the public to know?

They are doing this because they are doctors and scientists who actually understand the REAL science here, and who know the devastating potential consequences of those who choose to get this very toxic and dangerous vaccine, and they are trying to save as many people as possible from the carnage this vaccine is going to cause, which will include DEATH, brain injuries, life-long autoimmune disease, infertility, and more.

Please watch this video and their urgent pleas, and then share it with as many people as you can, because time is short!

See Also:

Doctors for Truth: Tens of Thousands Medical Professionals Suing and Calling for End to COVID Tyranny

COVID Vaccines “Biological Weapons of Mass Destruction” says Wyoming Medical Doctor and Manager for Wyoming’s State Public Health Department (Trending!)

Dr. Northrup Discusses “Worst Case Scenarios” with New COVID Vaccine Dangers

Dr. Judy Mikovits and Dr. Sherri Tenpenny: A New COVID Vaccine Could Kill 50 Million People in the U.S.

Censored Dr. Kaufman: “They Want To Genetically Modify Us With COVID-19 Vaccine” – Loses his Job and Willing to go to Jail to Resist

Published on December 11, 2020

Written by Iain Davis

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.

 Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

IDENTIFICATION OF WHAT EXACTLY?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.

The WHO’s Laboratory testing guidance states:

The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:

We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

VOYAGE OF DISCOVERY

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

ISOLATE NOTHING

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

At Principia Scientific International: Dr Saeed Qureshi & John O’Sullivan Reported: The Science That Exposes The COVID19 Virus As A Hoax

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

TESTING FOR NOTHING

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.

While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

• RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
• S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
• E gene (Orf1ab) – small membrane protein used in viral assembly
• N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.

Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

CONCLUSIVE FRAUD

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Read more at off-guardian.org

Please Donate Below To Support Our Ongoing Work To Expose The Lies About COVID19

PRINCIPIA SCIENTIFIC INTERNATIONAL, legally registered in the UK as a company incorporated for charitable purposes. Head Office: 27 Old Gloucester Street, London WC1N 3AX. 

Please DONATE TODAY To Help Our Non-Profit Mission To Defend The Scientific Method

German Neurologist Warns Against Wearing Facemasks: 'Oxygen Deprivation Causes Permanent Neurological Damage'

 

This is one of the most important posts I have ever made, so please read it. I have written a transcript of some highlights from Dr. Margarite Griesz-Brisson's recent and extremely pressing video message, which was translated from German into English by Claudia Stauber.

.
 

 

Original video by Griesz-Brisson   English Translated Video Here

Dr. Margarite Griesz-Brisson MD, PhD is a Consultant Neurologist and Neurophysiologist with a PhD in Pharmacology, with special interest in neurotoxicology, environmental medicine, neuroregeneration and neuroplasticity. This is what she has to say about facemasks and their effects on our brains:

"The reinhalation of our exhaled air will without a doubt create oxygen deficiency and a flooding of carbon dioxide. We know that the human brain is very sensitive to oxygen deprivation. There are nerve cells for example in the hippocampus that can't be longer than 3 minutes without oxygen - they cannot survive.

The acute warning symptoms are headaches, drowsiness, dizziness, issues in concentration, slowing down of reaction time - reactions of the cognitive system.

However, when you have chronic oxygen deprivation, all of those symptoms disappear, because you get used to it. But your efficiency will remain impaired and the under-supply of oxygen in your brain continues to progress.

We know that neurodegenerative diseases take years to decades to develop. If today you forget your phone number, the breakdown in your brain would have already started 20 or 30 years ago.

While you're thinking that you have gotten used to wearing your mask and rebreathing your own exhaled air, the degenerative processes in your brain are getting amplified as your oxygen deprivation continues.

The second problem is that the nerve cells in your brain are unable to divide themselves normally. So in case our governments will generously allow as to get rid of the masks and go back to breathing oxygen freely again in a few months, the lost nerve cells will no longer be regenerated. What is gone is gone.

I do not wear a mask, I need my brain to think. I want to have a clear head when I deal with my patients, and not be in a carbon dioxide-induced anaesthesia.

There is no unfounded medical exemption from face masks because oxygen deprivation is dangerous for every single brain. It must be the free decision of every human being whether they want to wear a mask that is absolutely ineffective to protect themselves from a virus.

For children and adolescents, masks are an absolute no-no. Children and adolescents have an extremely active and adaptive immune system and they need a constant interaction with the microbiome of the Earth. Their brain is also incredibly active, as it is has so much to learn. The child's brain, or the youth's brain, is thirsting for oxygen. The more metabolically active the organ is, the more oxygen it requires. In children and adolescents every organ is metabolically active.

To deprive a child's or an adolescent's brain from oxygen, or to restrict it in any way, is not only dangerous to their health, it is absolutely criminal. Oxygen deficiency inhibits the development of the brain, and the damage that has taken place as a result CANNOT be reversed.

The child needs the brain to learn, and the brain needs oxygen to function. We don't need a clinical study for that. This is simple, indisputable physiology. Consciously and purposely induced oxygen deficiency is an absolutely deliberate health hazard, and an absolute medical contraindication.

An absolute medical contraindication in medicine means that this drug, this therapy, this method or measure should not be used, and is not allowed to be used. To coerce an entire population to use an absolute medical contraindication by force, there must be definite and serious reasons for this, and the reasons must be presented to competent interdisciplinary and independent bodies to be verified and authorised.

When, in ten years, dementia is going to increase exponentially, and the younger generations couldn't reach their god-given potential, it won't help to say "we didn't need the masks".

How can a veterinarian, a software distributor, a businessman, an electrical car manufacturer and a physicist decide on matters regarding the health of the entire population? Please, dear colleagues, we all have to wake up.

I know how damaging oxygen deprivation is for the brain, cardiologists know how damaging it is for the heart, pulmonologists know how damaging it is for the lungs. Oxygen deprivation damages every single organ.

Where are our health departments, our health insurance, our medical associations? It would have been their duty to be vehemently against the lockdown and to stop it and stop it from the very beginning.

Why do the medical boards issue punishments to doctors who give people exemptions? Does the person or the doctor seriously have to prove that oxygen deprivation harms people? What kind of medicine are our doctors and medical associations representing?

Who is responsible for this crime? The ones who want to enforce it? The ones who let it happen and play along, or the ones who don't prevent it?

It's not about masks, it's not about viruses, it's certainly not about your health. It is about much much more. I am not participating. I am not afraid.

You can notice, they are already taking our air to breathe. The imperative of the hour is personal responsibility. We are responsible for what we think, not the media. We are responsible for what we do, not our superiors. We are responsible for our health, not the World Health Organisation. And we are responsible for what happens in our country, not the government."

There is no scientific evidence for the efficacy of facemasks against airborne virus transmission, but there is scientific evidence for the dangers of wearing facemasks.

SOURCE DOCUMENT WITH VIDEO