"Jesus understood the minds of men. He knew what was in the heart of man, and had his teachings been left as he presented them, the only commentary being the inspired interpretation afforded by his earth life, all nations and all religions of the world would speedily have embraced the gospel of the kingdom. The well-meant efforts of Jesus’ early followers to restate his teachings so as to make them the more acceptable to certain nations, races, and religions, only resulted in making such teachings the less acceptable to all other nations, races, and religions."

These discussions are about these truth postulates. In view of the fact that Jesus declared "If you have seen me, you have seen the Father" what is the value and the meaning of this quotation from the pages of the 5th Epochal Revelation?

Of all human knowledge, that which is of greatest value is to know the religious life of Jesus and how he lived it. 196:1.3

"Jesus understood the minds of men. He knew what was in the heart of man, and had his teachings been left as he presented them, the only commentary being the inspired interpretation afforded by his earth life, all nations and all religions of the world would speedily have embraced the gospel of the kingdom. The well-meant efforts of Jesus’ early followers to restate his teachings so as to make them the more acceptable to certain nations, races, and religions, only resulted in making such teachings the less acceptable to all other nations, races, and religions."

These discussions are about these truth postulates. In view of the fact that Jesus declared "If you have seen me, you have seen the Father" what is the value and the meaning of this quotation from the pages of the 5th Epochal Revelation?

Of all human knowledge, that which is of greatest value is to know the religious life of Jesus and how he lived it. 196:1.3

The Value of Study Groups

By Gard Jameson

There are many joys associated with becoming part of a group of readers which has as its main purpose a thorough study of The Urantia Book. A Study Group has the potential to "expand cosmic consciousness and enhance spiritual perception." (1.2) 0:0.2 And these are the two exalted purposes of the fifth epochal revelation.

If you are considering a study group you have made a decision of great consequence. You have decided to participate with a group of fellow human beings in an endeavor which has eternal implications. We live in a society which has a difficult time discussing religious or spiritual subjects, let alone universe cosmology. The Papers of The Urantia Book are precious and the opportunity to share them with others provides an experience of great learning and inspiration!

An Historical Perspective

Balanced participation, shared openness, intellectual discovery, a heightened sense of values, warm fellowship and good cookies: what could be a more superb focus for study than The Urantia Book?

In the early years of the revelation we were asked by the revelators to form thousands of study groups to enable this great message to evolve into the consciousness of the population. There are hundreds now in existence with many more on the horizon as many foreign translations of the book find their way into the hands of souls hungry for an enlarged perspective on the meaning of our existence. The need for more study groups is great. And so are the rewards for the group, the individual, and the planet.

The Urantia Book has much to say on the value of groups:

"A social group of human beings in co-coordinated working harmony stands for a force far greater than the simple sum of its parts."(1477.1) 133:5.6

"Intellectually, socially, and spiritually two moral creatures do not merely double their personal potentials of universe achievement by partnership technique; they more nearly quadruple their attainment and accomplishment possibilities."(494.10) 43:8.11

"Social architects do everything within their province and power to bring together suitable individuals that they may constitute efficient and agreeable working groups on earth…not always do these seraphim attain their ends; not always are they able to bring together those who would form the most ideal group to achieve a given purpose or to accomplish a certain task; under these conditions they must utilize the best of the material available." (432.6) 39:3.5

"But since personality is unique--no two mortals being alike--it inevitably follows that no two human beings can similarly interpret the leadings and urges of the spirit of divinity which lives within their minds. A group of mortals can experience spiritual unity, but they can never attain philosophic uniformity." (1129.8) 103:1.1

These quotes tell us that it is certainly in our best interest to come together as groups, and that furthermore, as we come together to achieve understanding and tasks, we must appreciate that we have little hope of achieving philosophic or intellectual uniformity! This last fact makes for a wonderful challenge that awaits you when you participate in a study group.

Study groups grow by the power of good will and intelligent organization which motivates and guides the members of the group. If people join together for study, to discover together new truths, to share their spiritual journey, remarkable things can and will happen. People who meet together for many years experience unconscious growth, a socialization and deepened friendships that are all too rare on our planet. There is a familial appreciation and regard that emerges over time when groups of interested individuals study The Urantia Book.

Setting Up a Study Group

Before even thinking about a group, make sure the purpose of your group is to study The Urantia Book. The purpose of a study group should be to study, socialize, expand personal insights, avoid isolation of religious experience and interpretation, and provide an arena for interpersonal contact and moral decision making. A study group facilitates the wonderful experience of learning how to work cooperatively as a team. "One of the most important lessons to be learned during your mortal career is teamwork." (312.1) 28:5.14

1. Making contact with potential group members.

Personal acquaintances who read the book or who are interested in the book are the best source of participants for a study group. If such individuals are not available, referrals from Urantia Foundation or the social organizations, the Urantia Association International or the Urantia Book Fellowship can be utilized. "Blind" contacts, such as an acquaintance of a friend or unsolicited phone calls should be followed up with an individual contact in a public place before inviting them to the meeting. This is especially true if you are female and are holding these meetings in your home. "Be as wise as serpents but as harmless as doves." (1580.8) 140:8.13

2. Consistency of time and place.

When forming a new group the time and place is most important. Try to get all the participants to agree upon the right time of the day and week. If there is a consensus it will make it easier to continue to be consistent. Consistency is imperative. People are so busy these days that calendars get filled weeks in advance. If the place changes too often, you will also see a drop in participation as readers struggle to remember which location is the right one for the date. If the situation cannot be helped, a written calendar is highly beneficial.

3. Physical surroundings.

The area must be equipped with proper lighting and with enough seating areas to be comfortable. Everyone should be able to see each other. A table is most appropriate if writing and referral to other notes are to be pursued. Coffee and tea or soft drinks with snacks can be served by the host or can be co-coordinated with the other members of the group. A little snack goes a long way to facilitating participation!

4. Attractions and Distractions.

Some Study Groups incorporate a moment of silent prayer and worship at the beginning and/or the end of the meeting. This facilitates the experience of fellowship.Some Study Groups have the members read out loud. Some groups utilize the audio version of the book in their study. It is a matter of preference and practicality.

Young children can be a distraction. The group must all agree on the policy of allowing children to be present. It will not work to allow some children and not others.

It is helpful to have the study aids that are popularly available, such as a Concordance or the Paramony (which traces Biblical references) or the Index of Subjects. It is also very useful to have a good dictionary on hand for reference purposes. Some study groups keep a computer nearby for word searches in the book.

Music or television will disturb the concentration of most readers and is another policy that must be agreed to by all.

Alcohol use by members of the group during the meeting can cause misunderstandings between readers and of the material being read. It is not recommended.

It is usually best not to allow smoking as well.

Punctuality is helpful as all readers have changed their schedules to be on time and hope to finish on time. A late arrival disturbs the concentration of the other readers and may cause some disturbance.

Continuity, particularly if the group is in the process of in-depth study, is a must. If different members are present at each meeting there can be no continuing discussion or understanding between readers. Commitment to continuity with a study group is most important. Participants should have a clear understanding of what lies ahead in the study of the book.

5. Group size considerations.

Seven or fewer can be the best size for many approaches. Informal or formal, it has the best chance for enhanced learning and social interaction.

Seven to fifteen readers will need a definite leader or moderator to initiate some structure and to ensure continuity of focus and study.

Fifteen to thirty members may necessitate prepared presentations and more order in the discussions with sensitive recognition of a member's need to speak. Recognizing that there are both introverts and extraverts among us, it is important to make sure that everyone's voice and heart is heard.

Thirty or more members may need more of a lecture format with the preparation of a leader necessary. Workshops with small break-out groups, also work with this number but must be somewhat structured and also have leaders in each group.

6. Study and social balance.

Both are essential to the purpose of a study group. The ratio should always be more study than social at the study group times and more social than study at the social gatherings, such as pot-lucks or celebrations, such as a Jesus birthday celebration.

Some typical study groups start at 7:00 PM with 15 minutes of social time while others arrive, then read until 8:45 or 9:00 with another 30 minutes for coffee and talk. It is important that on week nights people are considerate of everyone's need for getting home. This kind of group is usually once a week, or every-other week.

Other groups might meet on a weekend and have two hours of study with some socialization afterward.

7. Leadership

What degree of mastery of the book does one need in order to lead a study group? No one's mastery of the book is complete, but the leader should have read the book at least once. A good study leader should feel comfortable acknowledging that he or she does not know the answer to a given question. A study group leader is not an expert so much as a facilitator and moderator of group process. The point is for people to experience the discovery of new meanings and the lure of supernal values. Sometimes discovery flourishes most when the leader asks a question about a passage to which he or she truly does not know the answer. Sincere readers will always jump in to answer other's genuine questions.

If you have accepted responsibility of leadership of a group there are certain expectations other readers will have about your role, besides providing coffee, tea, and cookies. You must make it very clear your willingness to be responsible if you want others to participate in being responsible as well. Good study groups are a family affair. Always try to refresh your memory as to the text that will be read before each meeting.

Social control, ideally, is invisible, gracious and unconscious. Nobody, even the leader, should dominate the conversation. A healthy study group is one that maintains self-mastery over problems such as folks who wish to steer the meeting away from the book or emotionally troublesome individuals. A good group shares the responsibility of self-mastery. Individuals and groups differ in the degree to which they enjoy a more freewheeling discussion.

Many a study group limps or dies, however, due to inadequate social control.

Perseverance- the tenacity to pursue a worthy goal no matter who else cares to join, is a quality that must be practiced if a successful group is to flourish. One study group began with a husband and wife, who studied alone every week for about two years; then they were joined by another couple. After a few more years, more people joined, and after a decade there were sixty people coming to the group.

"Effort and decision are an essential part of the acquirement of survival values." (578.3) 50:6.3

"All this must be according to the Father's plan, which has predicated finite progress upon effort, creature achievement upon perseverance, and personality development upon faith." (1266.3) 115:7.2

When you are cleaning your house and setting up the chairs for your study group, keep in mind these quotes.

"Jesus always insisted that true goodness must be unconscious, in bestowing charity not allowing the left hand to know what the right hand does."(1582.7) 140:8.26

"Neither should you seek to lord it over your brethren in the kingdom. Remember, I have taught you that he who would be greatest among you should become the server of all. If you presume to exalt yourselves before God, you will certainly be humbled; but whoso truly humbles himself will surely be exalted. Seek in your daily lives, not self-glorification, but the glory of God. Intelligently subordinate your own wills to the will of the Father in heaven." (1907.2) 175:1.10

Teamwork

As early as 300,000 years ago in Dalamatia students were being taught to work, study, and fraternize with each other in teams. In The Urantia Book leaders are generally associated not with followers but with a team.

"In civilization much, very much, depends on an enthusiastic and effective load-pulling spirit. Ten men are of little more value than one in lifting a great load unless they lift together-all at the same moment. And such teamwork-social co-operation-is dependent on leadership." (911.2) 81:6.37

The superuniverse has its own seconaphim dedicated to teamwork!

"These are the angels who foster and promote the teamwork of all Orvonton. One of the most important lessons to be learned during your mortal career is teamwork." (312.1) 28:5.14

A lot has been written about groups--the different types of participation and non-participation, the ways of gaining and maintaining power, and the ways of managing groups to achieve different goals. It is a study on its own but we thought a quick look at some of the issues might be helpful.

Each group has an external boundary which determines membership and an internal boundary which determines leadership. Threats to group survival may come from within or from without.

Each person has a private, partly unconscious image of the group. These images greatly affect participation and affect how the structure of groups. The individual who functions as the leader in most of these images is the psychological leader. The person with the official responsibility may be somebody else; and the one who is the effective leader may be still a third person, the informal leader.

Groups have a rational, technical culture to get their job done, a traditional etiquette to enforce respect for each person, and an archaic emotional character as well.

If a group has only two roles, leader and follower, and two are leaders and there are ninety-eight followers, then the group is call 2% organized. A fully organized group has specific roles for each member. Increasing role differentiation promotes efficiency-the capacity to do work. If an efficient organization is neither undermanned not over manned, it cooperates more effectively--it actually gets the work done

Groups oppose irregularity, ethical or otherwise.

A crisis may be precipitated internally in a group by an individual who suddenly expresses concern for the group and brings the condition to the attention of all, calling for a change. An external crisis may be precipitated by competition or challenge from other groups. A crisis may or may not lead to renewal. The ultimate effect of any crisis will depend on the ability of the group leaders to utilize the lever of crisis for positive change.*

*THE STRUCTURE AND DYNAMICS OF ORGANIZATIONS AND GROUPS, by Eric Berne, (New York: Grove Press, 1963)

Dealing with Conflict

The Fathers' sovereignty in the heart of your group is all important for the lessening of conflict.

"Freewill beings who regard themselves as equals, unless they mutually acknowledge themselves as subject to some supersovereignty, some authority over and above themselves, sooner or later are tempted to try out their ability to gain power and authority over other persons and groups. The concept of equality never brings peace except in the mutual recognition of some over controlling influence of supersovereignty." (1487.6) 134:4.9

Study groups will bring you in contact with a multitude of personalities you would probably not have as friends or even acquaintances. This is not because they are not good people, but because their interests, age, backgrounds are so very different from yours that sometimes all you have in common is The Urantia Book. This can cause conflict and misunderstanding. Of course, there are all kinds of people and all come with their particular expectations and needs to your study group! You must be prepared for a certain quality of tension or conflict, which is not always bad.

"New religious insights arise out of conflicts which initiate the choosing of new and better reaction habits in the place of older and inferior reaction patterns. New meanings only emerge amid conflict; and conflict persists only in the face of refusal to espouse the higher values connoted in superior meanings." (1097.5) 100:4.1

"That individuals so differ in their life performances indicates, not only the varying endowments of heredity and the different influences of the environment, but also the degree of unification with the indwelling spirit of the Father which has been achieved by the self, the measure of the identification of the one with the other." (1480.3) 133:7.11

Though there may be profound differences in personality type and temperament within a study group, a spirit of worship conduces to a quality of unity that is astounding and refreshing.

Since most of us will not have a degree in psychology when we start, or participate in a group, all we can do is either go to the library or look to The Urantia Book.

"Jesus loved men so much because he placed such a high value upon them. You can best discover values in your associates by discovering their motivation. If some one irritates you, causes feelings of resentment, you should sympathetically seek to discern his viewpoint, his reasons for such objectionable conduct. If once you understand your neighbor, you will become tolerant, and this tolerance will grow into friendship and ripen into love." (1098.1) 100:4.4

But what if it doesn't? What if there is a person in the group who is determined to dominate, criticize, start arguments, concentrate on other subjects or in general disturb the meeting? The papers say (and there are many who can attest to the effectiveness of this technique), that the troublesome person should be taken aside by another sympathetic reader and told of the problem. If the unruly person does not change, then can two readers take this person aside, and if this still doesn't work, then the problem is taken to the group which has the final authority. In this way, all efforts have been extended to assist this person in becoming a meaningful part of the group. Please read the "Sermon on Forgiveness" for Jesus' own words on this subject of unruly persons.

"Can you not see that on this world such responsibilities had better rest upon the group or be administered by chosen representatives of the group?" (1469.1) 133:1.2

"You cannot truly love your fellows by a mere act of the will. Love is only born of thoroughgoing understanding of you neighbor's motive and sentiments. It is not so important to love all men today as it is that each day you learn to love one more human being." (1098.3) 100:4.6

Dealing with Individual Differences

One of the greatest conflicts in your study group will be the differences between idealists and realists. Abner was an visionary idealist, Paul was an pragmatic realist. Never argue with a dogmatic idealist because they are always right. In the scope of evolutionary development it just may not be time for whatever their ideal is, to be manifested. Marry idealism to dogmatism and you have a very difficult combination. Abner was a wonderful man. He loved the truth. Paul had ideas and it was a great pity the two did not work together. Abner refused to develop an organization while Paul decided to build an organization in a practical way.

"Paul went forth to build up one of the most progressive human societies which has ever existed on Urantia." (1865.6) 170:5.16

We can love and appreciate Abner, but we must respect Paul for his real accomplishments. Abner failed to manifest his ideals; Paul's cause lived and prospered. We are in the midst of a new revelation. It is imperative that we constantly evaluate our actions as we work in our social, service and study groups.

"Someday religionists will get together and actually effect co-operation on the basis of psychological opinions and theological beliefs. Goals rather than creeds should unify religionists...it is inevitable that each individual religionist must have his own and personal interpretation of the realization of that spiritual experience. Let the term 'faith' stand for the individual's relation to God rather than for the creedal formulation of what some group of mortals have been able to agree upon as a common religious attitude. 'Have you faith? Then have it to yourself.' " (1091.6) 99:5.7

Potential Pitfalls and Problems

No matter how well meaning we are, we can never quite see what we may be doing that may negatively affect the group. Here are a few reminders on how even the best of intentions may be perceived by your fellow man.

DESIRABLE ACTIVITY--------------CARRIED TO AN EXTREME

Pray for the meeting--------------------Become pious and ostentatious
Listen to others-------------------------Become non-responsive
Build morale----------------------------Become "goody-goody"
Contribute your own ideas--------------Dominate discussion
Share your own experience ------------Start an encounter group
Think-----------------------------------Become an intellectual snob
Inquire----------------------------------Ask too many shallow questions
Cultivate friendships---------------------Indulge in flattery or become meddlesome

The activities which occur in your study group should form an organic part of the efforts of our unseen benefactors to spiritualize humanity.

The Importance of Study

The word student comes from the Latin studere which means to be eager or zealous about. A student of The Urantia Book is eager about the facts, meanings, and values presented in its pages. The word scholar comes from the Greek schole, meaning leisure. A scholar of the book takes the extended, non-anxious time required for learning, free of the domination of any theological, ideological, or political purpose.

The Urantia Book itself contains a surprising amount of teaching on the subject of study. Study is one of the three main categories of activity for our morontia career.

"The activities of such a world are of three distinct varieties: work, progress, and play. Stated otherwise, they are: service, study, and relaxation." (526.4) 46:5.29

Study does not come easy for mortals, and only becomes truly voluntary later in our universe career. "Study is becoming voluntary, unselfish service natural, and worship spontaneous." (537.5) 47:7.5

Jesus engaged in intense study. (1420.7) 129:1.10 He memorized passages in early schooling.(1362.3) 123:5.2 His way in discussion was a model of "broadmindedness, fairness, and tolerance;" (1467.4) 132:7.8 and he was a patient listener.(1460.6) 132:4.2 His study group was earnest and joyous. (1533.5) 137:7.1

Perhaps the greatest revelation about reading comes at the end of the Foreword:

"We are fully cognizant of the difficulties of our assignment; we recognize the impossibility of fully translating the language of the concepts of divinity and eternity into the symbols of the language of the finite concepts of the mortal mind. But we know that there dwells within the human mind a fragment of God, and that there sojourns with the human soul the Spirit of Truth; and we further know that these spirit forces conspire to enable man to grasp the reality of spiritual values and to comprehend the philosophy of universe meanings. But even more certainly we know that these spirits of the Divine Presence are able to assist man in the spiritual appropriation of all truth contributory to the enhancement of the ever-progressing reality of personal religious experience--God consciousness."
(17.2) 0:12.12

In other words, there is a cycle of revelatory communication, beginning with the author and the original language, then translated into English, then printed and read by the human intellect, and then worked on by the Thought Adjuster and the Spirit of Truth to bring alive universe meaning and values.

We live in an age of partial illiteracy, superficial reading, and speed reading. Sometimes it is appropriate to skim material quickly, but the authors at times explicitly slow us down:

"Stop and ponder the solemn fact that God lives within you..." (39.5) 2:5.6

"Meditate on the revelation of these divine attributes which were made in loving service by your own Creator Son.."(89.5) 7:7.6

"Let the sublime knowledge of the mortal life of Jesus of Nazareth sink in to your souls . . . ."(228.5) 20:6.1

In reading the scriptures of the world, we are to "look for those eternally true and divinely beautiful teachings." (1769.3) 159:5.1

Why study parts of the book that describe realities remote from human experience?

"Of all human knowledge, that which is of greatest value is to know the religious life of Jesus and how he lived it." (2090.4) 196:1.3 But isn't there a hidden harmony between this priority and the following idea: "The narrative of human ascent from the mortal spheres of time to the divine realms of eternity constitutes an intriguing recital....this supernal adventure should be the supreme study of mortal man." (449.2) 40:7.4 "Man's terrestrial orientation, his cosmic insight, and his spiritual direct ionization are all enhanced by a better comprehension of universe realities and their techniques of interassociation, integration, and unification.." (1162.1) 106:0.1

Jesus had strikingly high standards in that he expected others to interpret the scriptures carefully and to recall truths that they had been taught. He called his students to read not only reflectively but also responsively; in other words, what do the meanings of the passage call for in terms of a moral response? He also never tired in pointing to the worshipful aspects of scripture, especially the Psalms. Often we overlook important points by failing to read carefully and with an eye to different levels of meaning;

"...there is much in the Scriptures that would have instructed you if you had only read with discernment." (1662.2) 148:5.5

"Do you not remember that it is written...?"(1662.2) 148:5.5

"Do you not remember that I said to you once before...?' (1841.3) 167:7.4

Jesus challenged Nathaniel, one of the smartest of the apostles: "But why do you refuse to comprehend the meaning of the record...?" (1660.6) 148:4.7

Again, it is important to realize that there are meanings to be discerned at the level of the imagination, at the level of reflective thought, at the level of the heart or feeling as well as at the level of the soul. This is the meaning of loving God with all of our strength, with all of our mind, with all of our heart and with all of our soul.

Reading, like listening, is an art and a test: "Think not only of the multitudes and how they hear the truth: take heed also to yourselves how you hear. Remember that I have many times told you: to him who has shall be given more, while from him who has not shall be taken away even that which he thinks he has." (1691.4) 151:3.1

Sometimes a reader can only see one side of a complex text. "It is just because the gospel of Jesus was so many-sided that within a few centuries students of the records of his teachings became divided up into so many cults and sects. This pitiful subdivision of Christian believers results from failure to discern in the Master's manifold teachings the divine oneness of his matchless life." (1866.3) 170:5.20

We read the papers sentence by sentence, sequentially. But there is also artistry to be discovered in the structure of the composition of sections, papers, parts, and the book as a whole.

"The wise philosopher will always look for the creative design which is behind, and pre-existent to, all universe phenomena." (42.6) 2:7.5

Regardless of what is going on in our lives and around us we can be confident in our Abba Father, that He will never leave us nor forsake us and that is hope.

Therefore we know that we are not alone and He is there to strengthen, provide, protect, heal, gives us peace, and whatever we need to succeed.

God's plan for us is good and he wants to give us hope and a future. God is always doing His part, what He says He will do, He always does, God does not lie, He is constant, therefore He never changes. So as you go through this week, keep your eyes on Jesus and not on your circumstances, He is the master of all storms.

Our part is to trust in the Lord with all our hearts and lean not on our own understanding, in all our ways, to acknowledge Him so that He can direct our pathway. Do not allow your circumstances or what is going on around you cause you to lose your focus on God. 

I know we are going through difficult times, not only in our own lives, and our nation but the whole world around us. There are so many destructions, there is the virus, floods, fires, hurricanes, wars, starvation, so many are people are suffering and dying and that cause us to worry, panic or even  start questioning God's existence in all of this.

When the Israelite went into captivity God was right there with them, He never left them, instead He said

"when they seek him with all their hearts, they will find Him." 

It is now time for us to seek God with all our hearts and find Him so He can bring us out of whatever captivity we are facing. Stay strong in the Lord and in the power of His Might.

Have a blessed week and stay always in prayer.

You shall not doubt that faith is the only requirement for eternal salvation. ~ The Urantia Book, (93:4.8).

In life, I loved you dearly, in death I love you still. In my heart you hold a place, no one else will ever fill. I cried endlessly when you died but I promise, I won't let the tears mar the smiles that you've given me when you were alive. I know you are listening from above. 

On this very special live broadcast of the DarkHorse podcast, Dr. Bret Weinstein (Ph.D) and Dr. Pierre Kory (M.D.) will discuss the ongoing pandemic, the care of COVID-19 patients, and the incredible story of Ivermectin.

[player url="https://odysee.com/@crotacheese75:e/DarkHorse-Podcast-with-Pierre-Kory-And-Bret-Weinstein:b" title="COVID, Ivermectin, and the Crime of the Century - DarkHorse Podcast with Pierre Kory & Bret Weinstein" summary="On this very special live broadcast of the DarkHorse podcast, Dr. Bret Weinstein (Ph.D) and Dr. Pierre Kory (M.D.) will discuss the ongoing pandemic, the care of COVID-19 patients, and the incredible ..."]

POSTED BY: DR. JOSEPH MERCOLA JUNE 22, 2021

In the video above, DarkHorse podcast host Bret Weinstein, Ph.D., an evolutionary biologist, interviews Dr. Robert Malone, the inventor of the mRNA and DNA vaccine core platform technology,¹ and Steve Kirsch, an entrepreneur who has been researching adverse reactions to COVID-19 gene therapies.

I realize that this is an absolutely epic three-hour interview but if you ever valued what I have been teaching, you must at a bare minimum very carefully read this entire article.

Malone is the scientist that actually invented the technology that makes the COVID jab possible and he spills the beans on just how this introduction has been ethically compromised to make informed consent absolutely impossible for the average person. Watch the interview if your schedule allows, but carefully read this article for sure.

[player url="https://www.youtube.com/watch?v=Du2wm5nhTXY" title="Spike protein is very dangerous, it's cytotoxic (Robert Malone, Steve Kirsch, Bret Weinstein)" summary="Spike protein is very dangerous, it's cytotoxic. Clip from DarkHorse podcast. Full livestream now CENSORED on YouTube.Odysee for backup: https://odysee.com/@..."]

Kirsch recently published the article, “Should You Get Vaccinated?” in which he reviews how and why he has changed his mind about the COVID-19 “vaccines.” This after he got both doses of the Moderna shot, as have his three daughters.

If you or someone you know is equivocal about the COVID jab, then please, you simply MUST read Kirsh’s article as it is clearly one of the best pieces written on the topic and provides the other side of the story that is NEVER given in the mainstream media. Remember, without full disclosure of the vaccine’s risk, it is impossible to have informed consent.² If you read Kirsch’s article, you will get, in great detail, the other side that the conventional media refuses to share. He writes:

“I recently learned that these vaccines have likely killed over 25,800 Americans (which I confirmed 3 different ways) and disabled at least 1,000,000 more. And we’re only halfway to the finish line. We need to PAUSE these vaccines NOW before more people are killed.

Based on what I now know about the miniscule vaccine benefits (approximately a 0.3% reduction in absolute risk), side effects (including death), current COVID rates, and the success rate of early treatment protocols, the answer I would give today to anyone asking me for advice as to whether to take any of the current vaccines would be, ‘Just say NO.’

The current vaccines are particularly contraindicated if you have already been infected with COVID or are under age 20. For these people, I would say ‘NO! NO! NO!’

In this article, I will explain what I have learned since I was vaccinated that totally changed my mind. You will learn how these vaccines work and the shortcuts that led to the mistakes that were made.

You will understand why there are so many side effects and why these are so varied and why they usually happen within 30 days of vaccination. You will understand why kids are having heart issues (for which there is no treatment), and temporarily losing their sight, and ability to talk. You will understand why as many as 3% may be severely disabled by the vaccine.”

The Spike Protein Is a Bioactive Cytotoxin

As explained by Malone, many months ago he warned the U.S. Food and Drug Administration that the spike protein — which the COVID-19 “vaccines” instruct your cells to make — could be dangerous. The FDA dismissed his concerns, saying they did not believe the spike protein was biologically active. Besides, the vaccine makers specifically designed the injections so that the spike protein would stick and not float about freely.

Well, they were wrong on both accounts. It’s since been well-established that, indeed, the SARS-CoV-2 spike protein gets free, and that it is biologically active and causes severe problems. It is responsible for the most severe effects seen in COVID-19, such as bleeding disorders, blood clots throughout the body and heart problems.

These are the same problems we now see in a staggering number of people having received one or two shots of COVID-19 “vaccine.” For more in-depth information about how the spike protein causes these problems, please see my interview with Stephanie Seneff, Ph.D., and Judy Mikovits, Ph.D.

Using the word vaccine isn’t really appropriate here, and I don’t want to contribute to the misuse of that word. These injections are clearly not vaccines. They don’t work like any previous conventional vaccines. As the actual inventor of the mRNA vaccines clearly says in the interview, they are gene therapy. So, please understand that when I say vaccine or vaccination, I’m really talking about gene therapy.

Spike Protein Disseminates Throughout Your Body

In a recent interview³ with Alex Pierson, Canadian immunologist and vaccine researcher Byram Bridle, Ph.D., discussed previously unseen research obtained from the Japanese regulatory agency through a freedom of information act request.

The study was a biodistribution study done by Pfizer, which showed that the mRNA in the vaccine does not stay in and around the vaccination site but is widely distributed in the body, as is the spike protein.⁴

This is a serious problem, as the spike protein is a toxin shown to cause cardiovascular and neurological damage. Once in your blood circulation, the spike protein binds to platelet receptors and the cells that line your blood vessels. When that happens, it can cause platelets to clump together, resulting in blood clots, and/or cause abnormal bleeding. I detailed these and other findings in “Researcher: ‘We Made a Big Mistake’ on COVID-19 Vaccine.”

Dangerous Corners Were Cut

The spike protein also has reproductive toxicity, and Pfizer’s biodistribution data show it accumulates in women’s ovaries. Kirsch cites data suggesting the miscarriage rate among women who get the COVID “vaccine” within the first 20 weeks of pregnancy is 82%.⁵ The normal rate is 10%, so this is no minor uptick. Kirsch writes:⁶

“It is baffling that the CDC says the vaccine is safe for pregnant women when it is so clear that this is not the case. For example, one our family friends is a victim of this. She miscarried at 25 weeks … She had her first shot 7 weeks ago, and her second shot 4 weeks ago.

The baby had severe bleeding of the brain and other disfigurements. Her gynecologist had never seen anything like that before in her life. They called in a specialist who said it was probably a genetic defect (because everyone buys into the narrative that the vaccine is safe it is always ruled out as a possible cause).

No VAERS report. No CDC report. Yet the doctors I’ve talked to say that it is over 99% certain it was the vaccine. The family doesn’t want an autopsy for fear that their daughter will find out it was the vaccine. This is a perfect example of how these horrible side effects just never get reported anywhere.”

Disturbingly, the Pfizer biodistribution data package reveals that corners were cut in the interest of speed, and one of the research facets that were skipped was reproductive toxicology. Yet, despite the lack of an initial reproductive toxicology investigation and a rapidly growing number of reports of miscarriages (which is likely to be a significant undercount), the Centers for Disease Control and Prevention is still urging pregnant women to get vaccinated. Why is that?

Is There Purposeful Suppression of VAERS Data?

What’s more, as discussed in the interview, there’s evidence that data in the Vaccine Adverse Event Reporting System (VAERS) is being manipulated as reports that were filed are now missing. Why were they removed? And without the filers’ consent?

Even with that manipulation, the number of deaths reported post-vaccination against COVID-19 is beyond anything we’ve ever seen. According to Kirsch, the rate of death from COVID-19 shots exceeds that of more than 70 vaccines combined over the past 30 years, and it’s about 500 times deadlier than the seasonal flu vaccine,⁷ which historically has been the most hazardous.

Other serious effects are also off the charts. For example, Israeli data show boys and men between the ages of 16 and 24 who have been vaccinated have 25 times the rate of myocarditis (heart inflammation) than normal.⁸ Additionally, many young people are actually dying as a result of this myocarditis.⁹

Malone points out that, in re-reading the most current version of the Emergency Use Authorization (EUA) that governs these COVID shots, he discovered that the FDA opted not to require stringent post-vaccination data collection and evaluation, even though they had the latitude to do so.

As noted by Weinstein, this is yet another anomaly that needs an answer. Why did they opt for such lax data capture, because without it, there’s no way of evaluating the safety of these products. You cannot identify the danger signals if you don’t have a process for capturing effects data and evaluating all of it.

“The whole logic of EUA is you’re basically substituting real-time capture of key information for prospective capture of key information,” Malone explains. “But to do that, you’ve got to get the information and it has to be rigorous.”

Other Anomalies

Furthermore, as noted by Weinstein, if you release a vaccine under emergency use — because you say there’s an unprecedented health emergency and there are no other options, therefore it’s worth taking a larger than normal risk — then you still would not give it to people who are at no or low risk of the disease in question.

This would include children, teens and healthy individuals under the age of 40, at bare minimum. Children appear naturally immune against COVID-19¹⁰ and have been shown to not be disease vectors,¹¹ and people under 40 have an infection fatality ratio of just 0.01%.¹² That means their chances of survival is 99.99%, which is about as good as it gets.

Pregnant women would also be excluded as they are a high-risk category for any experimentation, and anyone who has recovered from COVID would be excluded as they now have natural immunity and have no need for a vaccine whatsoever. In fact, a recent Cleveland Clinic study^13,14 found people who had tested positive for SARS-CoV-2 at least 42 days prior to vaccination reaped no additional benefit from the jabs.

Yet all of these incredibly low-risk groups are urged and even inappropriately incentivized to get vaccinated, and this too is anomalous behavior. Part of the risk-benefit analysis is not only the risk of serious outcomes and death from the disease, but also the availability of alternative treatments, and here we have the third massive anomaly.

We’ve seen a clear suppression of information showing that there are not just one but several effective remedies that could reduce the risk of COVID-19 to a number of cohorts down to virtually zero. Examples include hydroxychloroquine and ivermectin, both of which have been safely used for decades in many millions of people around the world.

The precautionary principle dictates that as long as a drug or treatment strategy doesn’t do harm, even if the positive effect may be small, it should be used until better data or better treatments becomes available. This is the logic they used with masks (even though the data overwhelmingly showed no statistical benefit and there are a number of potential harms).

But when it comes to hydroxychloroquine and ivermectin, they suppressed the use of these drugs even though they are extremely safe when used in the appropriate doses and have been shown to work really well in many dozens of studies. As noted by Kirsch in his article:¹⁵

“Repurposed drugs [such as hydroxychloroquine and ivermectin] are safer and more effective than the current vaccines. In general, early treatment with an effective protocol reduces your risk of dying by more than 100X so instead of 600,000 deaths, we’d have fewer than 6,000 deaths. NOTE: The vaccine has already killed over 6,000 people and that’s from the vaccine alone (and doesn’t count any breakthrough deaths).”

Doctors are also being muzzled and their warnings suppressed and censored. Dr. Charles Hoffe has administered Moderna’s COVID-19 “vaccine” to 900 of his patients. Three are now permanently disabled and one has died. After writing an open letter to Dr. Bonnie Henry, the provincial health officer for British Columbia, in which he stated that he’s “been quite alarmed at the high rate of serious side-effects from this novel treatment,”¹⁶ his hospital privileges were yanked.

Bioethics Laws Are Clearly Being Broken

In a May 30, 2021, essay,¹⁷ Malone reviewed the importance of informed consent, rightly concluding that censorship makes it so that informed consent simply cannot be given. Informed consent isn’t just a nice idea or an ideal. It is the law, both nationally and internationally. The current vaccine push also violates bioethical principles in general.

“By way of background, please understand that I am a vaccine specialist and advocate, as well as the original inventor of the mRNA vaccine (and DNA vaccine) core platform technology. But I also have extensive training in bioethics from the University of Maryland, Walter Reed Army Institute of Research, and Harvard Medical School, and advanced clinical development and regulatory affairs are core competencies for me,” Malone writes.

“Why is it necessary to suppress discussion and full disclosure of information concerning mRNA reactogenicity and safety risks? Let’s analyze the vaccine-related adverse event data rigorously. Is there information or patterns that can be found, such as the recent finding of the cardiomyopathy signals, or the latent virus reactivation signals?

We should be enlisting the best biostatistics and machine learning experts to examine these data, and the results should — no must — be made available to the public promptly. Please follow along and take a moment to examine the underlying bioethics of this situation with me …

The suppression of information, discussion, and outright censorship concerning these current COVID vaccines which are based on gene therapy technologies cast a bad light on the entire vaccine enterprise. It is my opinion that the adult public can handle information and open discussion. Furthermore, we must fully disclose any and all risks associated with these experimental research products.

In this context, the adult public are basically research subjects that are not being required to sign informed consent due to EUA waiver. But that does not mean that they do not deserve the full disclosure of risks that one would normally require in an informed consent document for a clinical trial.

And now some national authorities are calling on the deployment of EUA vaccines to adolescents and the young, which by definition are not able to directly provide informed consent to participate in clinical research — written or otherwise.

The key point here is that what is being done by suppressing open disclosure and debate concerning the profile of adverse events associated with these vaccines violates fundamental bioethical principles for clinical research. This goes back to the Geneva convention and the Helsinki declaration.¹⁸ There must be informed consent for experimentation on human subjects.”

Experimentation without proper informed consent also violates the Nuremberg Code,¹⁹ which spells out a set of research ethics principles for human experimentation. This set of principles were developed to ensure the medical horrors discovered during the Nuremberg trials at the end of World War II would never take place again.

Lines Have Been Crossed That Must Never Be Crossed

In the U.S., we also have the Belmont report,²⁰ cited in Malone’s essay, which spells out the ethical principles and guidelines for the protection of human subjects of research, covered under the U.S. Code of Federal Regulations 45 CFR 46 (subpart A). The Belmont report describes informed consent as follows:

“Respect for persons requires that subjects, to the degree that they are capable, be given the opportunity to choose what shall or shall not happen to them. This opportunity is provided when adequate standards for informed consent are satisfied.

While the importance of informed consent is unquestioned, controversy prevails over the nature and possibility of an informed consent. Nonetheless, there is widespread agreement that the consent process can be analyzed as containing three elements: information, comprehension and voluntariness.”

Americans, indeed the people of the whole earth, are being prevented from freely accessing and sharing information about these gene therapies. Worse, we are misled by fact checkers and Big Tech platforms that ban or put misinformation labels on anyone and anything discussing them in a critical or questioning way. The same censorship also prevents comprehension of risk.

Lastly, government and any number of vaccine stakeholders are encouraging companies and schools to make these experimental injections mandatory, which violates the rule of voluntariness. Government and private businesses are also creating massive incentives to participate in this experiment, including million-dollar lotteries and full college scholarships. None of this is ethical or even legal. As noted by Malone:²¹

“… as these vaccines are not yet market authorized (licensed), coercion of human subjects to participate in medical experimentation is specifically forbidden. Therefore, public health policies which meet generally accepted criteria for coercion to participate in clinical research are forbidden.

For example, if I were to propose a clinical trial involving children and entice participation by giving out ice cream to those willing to participate, any institutional human subjects safety board (IRB) in the United States would reject that protocol.

If I were to propose a clinical research protocol wherein the population of a geographic region would lose personal liberties unless 70% of the population participated in my study, once again, that protocol would be rejected by any US IRB based on coercion of subject participation. No coercion to participate in the study is allowed.

In human subject clinical research, in most countries of the world this is considered a bright line that cannot be crossed. So, now we are told to waive that requirement without even so much as open public discussion being allowed? In conclusion, I hope that you will join me; stop to take a moment and consider for yourself what is going on. The logic seems clear to me.

Again, if your schedule allows, I sincerely hope you take the time to listen to Weinstein’s interview with Malone and Kirsch. Yes, it is very long — about 3 ½ hours — but they are all astute in their observations, which makes for an enlightening conversation. And remember to read and widely share Kirsch’s article, “Should You Get Vaccinated?”²²

The National Vaccine Information Center (NVIC) recently posted more than 50 video presentations from the pay-for-view Fifth International Public Conference on Vaccination held online October 16 to 18, 2020, and made them available to everyone for free.

The conference’s theme was “Protecting Health and Autonomy in the 21st Century” and it featured physicians, scientists and other health professionals, human rights activists, faith community leaders, constitutional and civil rights attorneys, authors and parents of vaccine injured children talking about vaccine science, policy, law and ethics and infectious diseases, including coronavirus and COVID-19 vaccines.

In December 2020, a U.K. company published false and misleading information about NVIC and its conference, which prompted NVIC to open up the whole conference for free viewing. The conference has everything you need to educate yourself and protect your personal freedoms and liberties with respect to your health.

Don’t miss out on this incredible opportunity. I was a speaker at this empowering conference and urge you to watch these video presentations before they’re censored and taken away by the technocratic elite.

Read full story here…

.

Camilla Canepa

The parents of the 18-year-old who died: "She had no disease." The chief physician who operated on her: "Extremely severe thrombosis"

Back in 1921, a missionary couple named David and Svea Flood went with their two-year-old son from Sweden to the heart of Africa—to what was then called the Belgian Congo. They met up with another young Scandinavian couple, the Ericksons, and the four of them sought God for direction. In those days of much tenderness and devotion and sacrifice, they felt led of the Lord to go out from the main mission station and take the gospel to a remote area.

This was a huge step of faith. At the village of N’dolera they were rebuffed by the chief, who would not let them enter his town for fear of alienating the local gods. The two couples opted to go half a mile up the slope and build their own mud huts.

They prayed for a spiritual breakthrough, but there was none. The only contact with the villagers was a young boy, who was allowed to sell them chickens and eggs twice a week. Svea Flood—a tiny woman of only four feet, eight inches tall—decided that if this was the only African she could talk to, she would try to lead the boy to Jesus. And in fact, she succeeded.

But there were no other encouragements. Meanwhile, malaria continued to strike one member of the little band after another. In time the Ericksons decided they had had enough suffering and left to return to the central mission station. David and Svea Flood remained near N’dolera to go on alone.

Then, of all things, Svea found herself pregnant in the middle of the primitive wilderness. When the time came for her to give birth, the village chief softened enough to allow a midwife to help her. A little girl was born, whom they named Aina.

The delivery, however, was exhausting, and Svea Flood was already weak from bouts of malaria. The birth process was a heavy blow to her stamina. She lasted only another seventeen days.

Inside David Flood, something snapped in that moment. He dug a crude grave, buried his twenty-seven-year-old wife, and then took his children back down the mountain to the mission station. Giving his newborn daughter to the Ericksons, he snarled, “I’m going back to Sweden. I’ve lost my wife, and I obviously can’t take care of this baby. God has ruined my life.” With that, he headed for the port, rejecting not only his calling, but God himself.

Within eight months both the Ericksons were stricken with a mysterious malady and died within days of each other. The baby was then turned over to some American missionaries, who adjusted her Swedish name to “Aggie” and eventually brought her back to the United States at age three.

This family loved the little girl and was afraid that if they tried to return to Africa, some legal obstacle might separate her from them. So they decided to stay in their home country and switch from missionary work to pastoral ministry. And that is how Aggie grew up in South Dakota. As a young woman, she attended North Central Bible college in Minneapolis. There she met and married a young man named Dewey Hurst.

Years passed. The Hursts enjoyed a fruitful ministry. Aggie gave birth first to a daughter, then a son. In time her husband became president of a Christian college in the Seattle area, and Aggie was intrigued to find so much Scandinavian heritage there.

One day a Swedish religious magazine appeared in her mailbox. She had no idea who had sent it, and of course she couldn’t read the words. But as she turned the pages, all of a sudden a photo stopped her cold. There in a primitive setting was a grave with a white cross-and on the cross were the words SVEA FLOOD.

Aggie jumped in her car and went straight to a college faculty member who, she knew, could translate the article. “What does this say?” she demanded.

The instructor summarized the story: It was about missionaries who had come to N’dolera long ago...the birth of a white baby...the death of the young mother...the one little African boy who had been led to Christ...and how, after the whites had all left, the boy had grown up and finally persuaded the chief to let him build a school in the village. The article said that gradually he won all his students to Christ...the children led their parents to Christ...even the chief had become a Christian. Today there were six hundred Christian believers in that one village...

All because of the sacrifice of David and Svea Flood.

For the Hursts’ twenty-fifth wedding anniversary, the college presented them with the gift of a vacation to Sweden. There Aggie sought to find her real father. An old man now, David Flood had remarried, fathered four more children, and generally dissipated his life with alcohol. He had recently suffered a stroke. Still bitter, he had one rule in his family: “Never mention the name of God-because God took everything from me.”

After an emotional reunion with her half brothers and half sister, Aggie brought up the subject of seeing her father. The others hesitated. “You can talk to him,” they replied, “even though he’s very ill now. But you need to know that whenever he hears the name of God, he flies into a rage.”

Aggie was not to be deterred. She walked into the squalid apartment, with liquor bottles everywhere, and approached the seventy-three-year-old man lying in a rumpled bed.

“Papa?” she said tentatively.

He turned and began to cry. “Aina,” he said, “I never meant to give you away.”

“It’s all right Papa,” she replied, taking him gently in her arms. “God took care of me.”

The man instantly stiffened. The tears stopped.

“God forgot all of us. Our lives have been like this because of Him.” He turned his face back to the wall.

Aggie stroked his face and then continued, undaunted.

“Papa, I’ve got a little story to tell you, and it’s a true one. You didn’t go to Africa in vain. Mama didn’t die in vain. The little boy you won to the Lord grew up to win that whole village to Jesus Christ. The one seed you planted just kept growing and growing. Today there are six hundred African people serving the Lord because you were faithful to the call of God in your life...

“Papa, Jesus loves you. He has never hated you.”

The old man turned back to look into his daughter’s eyes. His body relaxed. He began to talk. And by the end of the afternoon, he had come back to the God he had resented for so many decades.

Over the next few days, father and daughter enjoyed warm moments together. Aggie and her husband soon had to return to America—and within a few weeks, David Flood had gone into eternity.

A few years later, the Hursts were attending a high-level evangelism conference in London, England, where a report was given from the nation of Zaire (the former Belgian Congo). The superintendent of the national church, representing some 110,000 baptized believers, spoke eloquently of the gospel’s spread in his nation. Aggie could not help going to ask him afterward if he had ever heard of David and Svea Flood.

“Yes, madam,” the man replied in French, his words then being translated into English. “It was Svea Flood who led me to Jesus Christ. I was the boy who brought food to your parents before you were born. In fact, to this day your mother’s grave and her memory are honored by all of us.”

He embraced her in a long, sobbing hug. Then he continued, “You must come to Africa to see, because your mother is the most famous person in our history.”

In time that is exactly what Aggie Hurst and her husband did. They were welcomed by cheering throngs of villagers. She even met the man who had been hired by her father many years before to carry her back down the mountain in a hammock-cradle.

The most dramatic moment, of course, was when the pastor escorted Aggie to see her mother’s white cross for herself. She knelt in the soil to pray and give thanks. Later that day, in the church, the pastor read from John 12:24: “I tell you the truth, unless a kernel of wheat falls to the ground and dies, it remains only a single seed. But if it dies, it produces many seeds.” He then followed with Psalm 126:5: “Those who sow in tears will reap with songs of joy.”

(An excerpt from Aggie Hurst, Aggie: The Inspiring Story of A Girl Without A Country [Springfield, MO: Gospel Publishing House, 1986].)

ARTICAL SOURCE

A message from the new revelations from Jesus.

"Forget not that I will stop at nothing to restore self-respect to those who have lost it, and who really desire to regain it."

CLICK IMAGE AVOVE TO HEAR THE DISCUSSION TOPIC

CLICK IMAGE TO HEAR THE DISCUSSIONS 

WATCH HIGHWIRE VIDEO

World renown vaccine specialist, Geert Vanden Bossche, gave a groundbreaking interview this week risking his reputation and his career by bravely speaking out against administration of #Covid19 vaccines. In what may be one of the most important stories ever covered by The Highwire, the vaccine developer shared his extreme concerns about these vaccines in particular and why we may be on track to creating a global immunity catastrophe.

Internet Source TheHighWire.com

CLICK IMAGE ABOVE TO HEAR EXPERT MEDICAL OPINIONS

also view this interview between concerned doctors

James Perloff shares information from his new book titled COVID-19 and the Agendas to Come, Red-Pilled which reveals what the social engineers have in store for the future of humanity.

COVID-19 AND THE AGENDAS TO COME, RED-PILLED

I grew up in a poor family with my grandmother. I wanted to be a doctor but that dream didn't come true to lack of school fees.That is why I decided to start this ministry so that children can fulfil their dreams not to be like me."

Dire WARNING: DO NOT GET THE COVID VACCINE!!

by Brian Shilhavy
Editor, Health Impact News

In an effort to combat Big Pharma Corporate Media and Big Tech censorship, doctors around the world are frantically trying to warn the masses of the devastating effects of the experimental COVID vaccines about to be mass injected into the unsuspecting public assisted by military forces around the world.

What could possibly motivate these doctors, nurses, scientists, and other health professionals to make such an impassioned plea? What do they have to gain by taking the time to educate the public on the hidden dangers of a new class of vaccine about to be inflicted upon the citizens of countries around the world?

They have NOTHING TO GAIN, and much to lose, including their careers, and possibly even their lives.

So why are they doing this? Why are these doctors and professionals being censored so much if the new COVID vaccines are in fact “safe and effective”? What is it that the media and the government are hiding that they don’t want the public to know?

They are doing this because they are doctors and scientists who actually understand the REAL science here, and who know the devastating potential consequences of those who choose to get this very toxic and dangerous vaccine, and they are trying to save as many people as possible from the carnage this vaccine is going to cause, which will include DEATH, brain injuries, life-long autoimmune disease, infertility, and more.

Please watch this video and their urgent pleas, and then share it with as many people as you can, because time is short!

See Also:

Doctors for Truth: Tens of Thousands Medical Professionals Suing and Calling for End to COVID Tyranny

COVID Vaccines “Biological Weapons of Mass Destruction” says Wyoming Medical Doctor and Manager for Wyoming’s State Public Health Department (Trending!)

Dr. Northrup Discusses “Worst Case Scenarios” with New COVID Vaccine Dangers

Dr. Judy Mikovits and Dr. Sherri Tenpenny: A New COVID Vaccine Could Kill 50 Million People in the U.S.

Censored Dr. Kaufman: “They Want To Genetically Modify Us With COVID-19 Vaccine” – Loses his Job and Willing to go to Jail to Resist

Published on December 11, 2020

Written by Iain Davis

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.

 Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

IDENTIFICATION OF WHAT EXACTLY?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.

The WHO’s Laboratory testing guidance states:

The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:

We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

VOYAGE OF DISCOVERY

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

ISOLATE NOTHING

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

At Principia Scientific International: Dr Saeed Qureshi & John O’Sullivan Reported: The Science That Exposes The COVID19 Virus As A Hoax

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

TESTING FOR NOTHING

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.

While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

• RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
• S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
• E gene (Orf1ab) – small membrane protein used in viral assembly
• N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.

Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

CONCLUSIVE FRAUD

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Read more at off-guardian.org

Please Donate Below To Support Our Ongoing Work To Expose The Lies About COVID19

PRINCIPIA SCIENTIFIC INTERNATIONAL, legally registered in the UK as a company incorporated for charitable purposes. Head Office: 27 Old Gloucester Street, London WC1N 3AX. 

Please DONATE TODAY To Help Our Non-Profit Mission To Defend The Scientific Method

COMPARE, by Tom Allen:

 Most institutions demand unqualified faith; but the institution of science makes       skepticism a virtue.
  --Robert King Merton, sociologist (1910-2003)

 UB (102:1.3) The more of science you know, the less sure you can be; the more of religion   you have, the more certain you are.

    Robert King Merton was an American sociologist. He spent most of his career teaching at Columbia University, where he attained the rank of University Professor. In 1994 he was awarded the National Medal of Science for his contributions to the field and for having founded the sociology of science. He is considered a founding father of modern sociology.

    Merton developed notable concepts such as "unintended consequences", the "reference group", and "role strain", but is perhaps best known for the terms "role model" and "self-fulfilling prophecy". A central element of modern sociological, political, and economic theory, the "self-fulfilling prophecy" is a process whereby a belief or expectation, correct or incorrect, affects the outcome of a situation or the way a person or group will behave.

    Merton's work on the "role model" first appeared in a study on the socialization of medical students at Columbia University. The term grew from his theory of the reference group, the group to which individuals compare themselves but to which they do not necessarily belong. Social roles were central to Merton's theory of social groups. Merton emphasized that, rather than a person assuming one role and one status, they have a status set in the social structure that has, attached to it, a whole set of expected behaviors.

.

A NEW BEGINNING FOR UGANDA

MISSION STATEMENT

" TO PROMOTE EDUCATION TO THE MOST VULNERABLE CHILDREN AND PRODUCE A COHERENT SELF RELIANT SCIENCE ORIENTED CITIZENS"

We need to have a kindergarten and or a primary school started next year in the little village of "Buseru", with this I have done an initial part of the work with my husband Moses. 

We have the land on which we can have this built in the countryside and this will help the UB to be put in the foundation of the minds of the children so that as they grow up , they will be better citizens, this very idea Moses told me he had discussed with Paul & Monica Kemp when he was engaged in the study of the revelations at their home in Nova Scotia Canada.

In addition to that, we have some bricks already to help us start the building, we shall need  a few more things to begin this project.

Request to Paul Kemp: I would request you help me formulate the name of this school in relationship to the UB but you include something to do with " New hope" help me make some writings that I will put on the banners. (see above banner) 

We are hoping members of the greater Urantia Family see the potential of this project and lend a helping hand in the formation and funding of this project in both material assets and educational materials.

Musagala Diana Caroline

THE TREE OF LEARNING, RELIGION, PHILOSOPHY, COSMOLOGY